Una canción himno de la generación de argentinos a la cual pertenezco, fue el tema Presente, que decía mas o menos algo así como todo tiene un final todo termina. Nada más cierto. 
Descalabra un poco darse cuenta de los finales y a veces tal es el dolor que uno ve que todo se rompe en mil pedazos y sigue empecinado en pegar las partes. Y ahí va la cosa toda arreglada con alambres, funcionando maltrechamente, pero todavía con vida.

La magia tiene un encantamiento levemente duradero, tiene fecha de vencimiento. Un día no abre mas los ojos. Casi todo lo mágico se desvanece y nos queda la descarnada cara de la realidad. Es feo, lo sé. Todos lo sabemos y cuando algo nos resultó mágico y vemos que se está convirtiendo en un cascajo, miramos para otro lado, por el enorme amor que le tenemos a eso que nos dio tanta felicidad.
No me estoy refiriendo al cónyuge.
Hablo de un lavarropas.
¿Acaso hay algo más mágico que esto en la vida de una mujer, esposa y madre?
Pero cuando tu lavarropas se convierte en helicóptero, algo raro sucede.
Cuando tu lavarropas que además de todo eso maravilloso que hacía, era silencioso, quiere remontar vuelo estruendosamente adentro de tu lavadero, estás frente a un problema.
Hay algo peor que esto y que como usuarios de electrodomésticos puede sucedernos a todos.
Lo peor es cuando el lavadero, no es tuyo, el lavarropas devenido en helicóptero de la segunda guerra mundial tampoco es tuyo y todo eso linda con tu adorada casa, recién terminada de construir.
Y aún hay algo peor, cuando tu vecino por alguna extraña razón relacionada con el odio hacia sus congéneres, pone en funcionamiento esa cosa desencantada de toda magia a las dos de la mañana, cuestión que cuando empieza el interminable centrifugado, el tacatacatacataaacaaaataaaacaaaaa en mi oído, en mi corazón y en mi sangre, despierta mi adormecido instinto asesino y comienzo a planear diferentes maneras de demostrarle al pelmazo de mi vecino, que todo tiene un final y todo termina. Juro que no pienso ir a cantarle en son de paz la primer estrofa de Presente, todo el tiempo del centrifugado me debato entre pasar por su casa con una topadora o derribar su puerta cual Uma Thurman en Kill Bill.

10 Comentarios

  1. Puedes matarlo tranquilamente.
    Ese ruido es una circunstancia eximente de responsabilidad criminal.
    Es más, incluso puede que te den una medalla al civismo.

    Adelante.


    Besos.

  2. Ayy!!! si que conozco de lavarropas convertidos en helicopteros de la segunda guerra mundial.
    Yo opino como Toro, podés eliminarlo, con justa razón, pues está prohibido tener armas de guerra.

    Lindo texto Pato. Un beso grande.

  3. Genín says:

    Ni propuesta es derribar su puerta cual Uma Thurman en Kill Bill.
    Ni siquiera te llevarán a comisaria, como dice Torito, te darán una medalla por tener un desconsiderado menos...jajaja
    Salud y besitos

  4. Badanita says:

    jajajaa.
    Cúanto me hiciste reir !!!
    Ayyyy ... mejor voy yo, total vos si vas en cana tenés marido e hijos pero yo NOOOOO.

    tqm.
    Andy

  5. Sheol13 says:

    Que arte en llevar el hilo de la historia, me ha encantado, pero lo siento por ti¿o por el vecino? no estoy seguro. Un abrazo.

  6. Codorníu says:

    Seguro que tienes medios hábiles de sobra para zanjar ese dislate. Si después de todo no hay más remedio que actuar llevado por el torrente sanguíneo, métele un explosivo a la puta lavadora. El resultado será óptimo y no irás a la cárcel.

    Ya sabes que se lee mejor que se vive.

    Un beso, amiga.

  7. buf, puedo ponerme en tu piel perfectamente,tengo algunos (he dicho algunos,no uno) que son un monumento al troll,y hay dias en los que me voy de casa para no oirles, o lo que es peor, salir a la terraza con un lanzallamas e incinerarlos.¿no tienes manera de cortocircuitarle la instalación?
    sabotaje, esa es la palabra.El monje dixit:)Besos***

  8. paolav says:

    jajaja...no hay nada peor ¡Definitivamente! Las cosas domésticas tiene una vida propia.
    Un abrazo y gracias por tu mensaje el otro día, te escribiré.

  9. Matias B. says:

    Todo tiene un final, todo termina, y el lavarropas tiene una vida útil, que pronto llegará a su fin.

    Suerte con eso.

    Firma: El Guacho Martín F., en su versión careta.

  10. Malena says:

    Ay, los vecinos.
    AY, LOS VECINOS!!!!!!!!

    Yo a los míos les deseo de todo corazón que hereden muchas hectareas de campo y se muden para que el ojo del amo engorde al ganado.

    Los míos cantan, no centrifugan. Y hacen reuniones multitudinarias hasta alta hora de la madrugada ... cualquier día de la semana.

Gracias por tus palabras